Review



halo tagged sec61β  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc halo tagged sec61β
    Halo Tagged Sec61β, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/halo+tagged+sec61%CE%B2/mEmerald-Sec61-C-18+(Plasmid+%2354249)/pmc04785223__ncomms10778___s1-71-2-5
    Average 94 stars, based on 16 article reviews
    halo tagged sec61β - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Two-colour live-cell nanoscale imaging of intracellular targets
    Article Snippet: .. To generate Halo-tagged Sec61β, mEmerald-Sec61β-C-18 (Addgene plasmid #54249, Davidson lab, unpublished) was cut with NheI and BglII and Halo tag was inserted as a NheI-BglII fragment. .. Halo was amplified with the following oligos: Halo-s 5’-cctaggctagcatggcagaaatcggtactggctttccat-3’ and Halo-as 5’- gagccagatcttgatccggagccggaaatctcgagcgtcgacagccagcg-3’.



    Similar Products

    halo tagged sec61β  (Addgene inc)
    94
    Addgene inc halo tagged sec61β
    Halo Tagged Sec61β, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/halo+tagged+sec61%CE%B2/mEmerald-Sec61-C-18+(Plasmid+%2354249)/pmc04785223__ncomms10778___s1-71-2-5
    Average 94 stars, based on 1 article reviews
    halo tagged sec61β - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results